Description

Ribosome profiles of elongating ribosomes from control and rapamycin & PP242 treated PC3 cells (Hsieh et al. 2012)

Methods

Raw sequence data were obtained from NCBI GEO database (Series GSE35469). Data from the following samples were concatenated before processing:

GSM869037 Footprint for vehicle treated PC3 cells, replicate #1
GSM869043 Footprint for vehicle treated PC3 cells, replicate #2
GSM869039 Footprint for rapamcin treated PC3 cells, replicate #1
GSM869045 Footprint for rapamcin treated PC3 cells, replicate #2
GSM869041 Footprint for PP242 treated PC3 cells, replicate #1
GSM869047 Footprint for PP242 treated PC3 cells, replicate #2

Cutadapt was used to trim the adaptor sequence "TCGTATGCCGTCTTCTGCTTG" from reads, after which reads below 25 nucleotides in length were discarded. An alignment to ribosomal RNA was then performed using Bowtie, and aligning reads were discarded. Finally, an alignment to the hg19 genome assembly was performed using RUM, and this track contains the normalised uniquely mapping reads that align to the A-site (using an offset of 15nt).

References

Hsieh, A. C., Liu, Y., Edlind, M. P., Ingolia, N. T., Janes, M. R., Sher, A., Shi, E. Y., et al. (2012). The translational landscape of mTOR signalling steers cancer initiation and metastasis. Nature. Nature Publishing Group. doi:10.1038/nature10912