Cybrid & BJ: Rooijers 2013 Track Settings
 
Ribo-seq unique mappers from BJ fibroblast cells, normal cybrid cells and cybrid cells with a tRNA(Trp)5556G4A mutation (Rooijers et al. 2013)   (All Elongating Ribosomes (Footprints) tracks)



Display mode:       Reset to defaults

Type of graph:
Track height: pixels (range: 11 to 128)
Data view scaling: Always include zero: 
Vertical viewing range: min:  max:   (range: 0 to 127)
Transform function:Transform data points by: 
Windowing function: Smoothing window:  pixels
Negate values:
Draw y indicator lines:at y = 0.0:    at y =
Graph configuration help
List subtracks: only selected/visible    all  
hide
 BJ  Ribo-seq unique mappers from BJ fibroblast cells (Rooijers et al. 2013)   schema 
hide
 Cybrid: control  Ribo-seq unique mappers from control cybrid cells (Rooijers et al. 2013)   schema 
hide
 Cybrid: mutated tRNA  Ribo-seq unique mappers from cybrid cells with a tRNA(Trp)5556G4A mutation (Rooijers et al. 2013)   schema 

Description

These tracks show the coverage data for uniquely mapping reads to the human genome from ribosome profiling experiments on elongating ribosomes from from BJ fibroblast cells, normal cybrid cells and cybrid cells with a tRNA(Trp)5556G4A mutation (Rooijers et al. 2013)

Methods

Raw sequence data were obtained from NCBI SRA database (Series GSE48933). Data from the following samples were concatenated before processing:

GSM1187134 BJ_RP_rep1
GSM1187135 BJ_RP_rep2
GSM1187138 Cybrid_control_RP_rep1
GSM1187139 Cybrid_control_RP_rep2
GSM1187140 Cybrid_tRNA_Trp_5556GA_RP_rep1
GSM1187141 Cybrid_tRNA_Trp_5556GA_RP_rep2

Cutadapt was used to trim the adaptor sequence (either "TCGTATGCCGTCTTCTGCT" or "TGGAATTCTCGGGTGCCAAGG") from reads, after which reads below 25 nucleotides in length were discarded. An alignment to ribosomal RNA was then performed using Bowtie, and aligning reads were discarded. Finally, an alignment to the hg19 genome assembly was performed using RUM, and this track contains coverage data for uniquely mapping reads from that alignment.

References

Rooijers, K., Loayza-Puch, F., Nijtmans, L. G., and Agami, R. (2013). Ribosome profiling reveals features of normal and disease-associated mitochondrial translation. Nature Communications, DOI: 10.1038/ncomms3886