Description These tracks show the coverage data for uniquely mapping reads to the human genome from ribosome profiling experiments on elongating ribosomes from from BJ fibroblast cells, normal cybrid cells and cybrid cells with a tRNA(Trp)5556G4A mutation (Rooijers et al. 2013) Methods
Raw sequence data were obtained from NCBI SRA database (Series GSE48933). Data from the following samples were concatenated before processing:
| GSM1187134 | BJ_RP_rep1 |
| GSM1187135 | BJ_RP_rep2 |
| GSM1187138 | Cybrid_control_RP_rep1 |
| GSM1187139 | Cybrid_control_RP_rep2 |
| GSM1187140 | Cybrid_tRNA_Trp_5556GA_RP_rep1 |
| GSM1187141 | Cybrid_tRNA_Trp_5556GA_RP_rep2 |
Cutadapt was used to trim the adaptor sequence (either "TCGTATGCCGTCTTCTGCT" or "TGGAATTCTCGGGTGCCAAGG") from reads, after which reads below 25 nucleotides in length were discarded. An alignment to ribosomal RNA was then performed using Bowtie, and aligning reads were discarded. Finally, an alignment to the hg19 genome assembly was performed using RUM, and this track contains coverage data for uniquely mapping reads from that alignment.
References
Rooijers, K., Loayza-Puch, F., Nijtmans, L. G., and Agami, R. (2013). Ribosome profiling reveals features of normal and disease-associated mitochondrial translation. Nature Communications, DOI: 10.1038/ncomms3886
|