Description Ribosome profiles of elongating ribosomes from BJ fibroblast cells, normal cybrid cells and cybrid cells harbouring the tRNA(Trp)5556G4A mutation (Rooijers et al. 2013) Methods
Raw sequence data were obtained from NCBI SRA database (Series GSE48933). Data from the following samples were processed:
| GSM1187134 | BJ_RP_rep1 |
| GSM1187135 | BJ_RP_rep2 |
| GSM1187138 | Cybrid_control_RP_rep1 |
| GSM1187139 | Cybrid_control_RP_rep2 |
| GSM1187140 | Cybrid_tRNA_Trp_5556GA_RP_rep1 |
| GSM1187141 | Cybrid_tRNA_Trp_5556GA_RP_rep2 |
Cutadapt was used to trim the relevant adaptor sequence (either "TCGTATGCCGTCTTCTGCT" or "TGGAATTCTCGGGTGCCAAGG") from reads, after which reads below 25 nucleotides in length were discarded. An alignment to ribosomal RNA was then performed using Bowtie, and aligning reads were discarded. Finally, an alignment to the hg19 genome assembly was performed using RUM, and this track contains the uniquely mapping reads that align to the A-site (using an offset of 15nt).
References
Rooijers, K., Loayza-Puch, F., Nijtmans, L. G., and Agami, R. (2013). Ribosome profiling reveals features of normal and disease-associated mitochondrial translation. Nature Communications, DOI: 10.1038/ncomms3886
|
|