HFF:Stern-Ginossar 2012 Track Settings
 
HHV5 infection of human fibroblast cells (Stern-Ginossar 2012)   (All Initiating Ribosomes (P-site) tracks)



Display mode:       Reset to defaults

Type of graph:
Track height: pixels (range: 11 to 128)
Data view scaling: Always include zero: 
Vertical viewing range: min:  max:   (range: 0 to 127)
Transform function:Transform data points by: 
Windowing function: Smoothing window:  pixels
Negate values:
Draw y indicator lines:at y = 0.0:    at y =
Graph configuration help
List subtracks: only selected/visible    all  
hide
 All  All ribosome profiling experiment data (Stern-Ginossar et al. 2012)   schema 
hide
 Harr 5hr  Ribosome profiles of initiating ribosomes from HFF cells pretreated with harringtonine and infected with HHV5 for 5 hours (Stern-Ginossar 2012)   schema 
hide
 Harr 72hr  Ribosome profiles of initiating ribosomes from HFF cells pretreated with harringtonine and infected with HHV5 for 72 hours (Stern-Ginossar 2012)    schema 
hide
 LTM 5hr  Ribosome profiles of initiating ribosomes from HFF cells pretreated with LTM and infected with HHV5 for 5 hours (Stern-Ginossar 2012)   schema 
hide
 LTM 72hr  Ribosome profiles of initiating ribosomes from HFF cells pretreated with LTM and infected with HHV5 for 72 hours (Stern-Ginossar 2012)    schema 

Description

These tracks contain data for uniquely mapping reads to the human genome from ribosome profiling experiments on initiating ribosomes by Stern-Ginossar et al. (2012). In a set of experiments human fibroblasts were infected with human herpesvirus 5 strain Merlin and profiling was performed at different time points.

Methods

Raw sequence data were obtained from NCBI GEO database (Series GSE41605).

Cutadapt was used to trim the adaptor sequence "CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAA" from reads. An alignment to ribosomal RNA was then performed using Bowtie, and aligning reads were discarded. Finally, an alignment to both reference genomes (NCBI Reference Sequences:NC_006273 and GRCh37) was performed using RUM.

References

Stern-Ginossar, N., Weisburd, B., Michalski, A., Le, V. T. K., Hein, M. Y., Huang, S.-X., Ma, M., et al. (2012).Decoding human cytomegalovirus. Science (New York, N.Y.), 338(6110), 1088-93. doi:10.1126/science.1227919