Description
These tracks contain data for uniquely mapping reads to the human genome from ribosome profiling experiments on initiating ribosomes by Stern-Ginossar et al. (2012). In a set of experiments human fibroblasts were infected with human herpesvirus 5 strain Merlin and profiling was performed at different time points.
Methods
Raw sequence data were obtained from NCBI GEO database (Series GSE41605).
Cutadapt was used to trim the adaptor sequence "CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAA" from reads. An alignment to ribosomal RNA was then performed using Bowtie, and aligning reads were discarded. Finally, an alignment to both reference genomes (NCBI Reference Sequences:NC_006273 and GRCh37) was performed using RUM.
References
Stern-Ginossar, N., Weisburd, B., Michalski, A., Le, V. T. K., Hein, M. Y., Huang, S.-X., Ma, M., et al. (2012).Decoding human cytomegalovirus. Science (New York, N.Y.), 338(6110), 1088-93. doi:10.1126/science.1227919
|
  |