LCL: Cenik 2015 Track Settings
 
Ribosome Profiling and RNA sequencing experiments from human lymphoblastoid cells (Cenik et al. 2015)   (All Elongating Ribosomes (A-site) tracks)

Display mode:       Reset to defaults

Overlay method:
Type of graph:
Track height: pixels (range: 11 to 128)
Data view scaling: Always include zero: 
Vertical viewing range: min:  max:   (range: 0 to 127)
Transform function:Transform data points by: 
Windowing function: Smoothing window:  pixels
Negate values:
Draw y indicator lines:at y = 0.0:    at y =
Graph configuration help
All subtracks:
List subtracks: only selected/visible    all    ()  
     GM10847  Ribosome profiles of human lymphoblastoid cell line GM10847 (Cenik et al. 2015)   Schema 
     GM12878  Ribosome profiles of human lymphoblastoid cell line GM12878 (Cenik et al. 2015)   Schema 
     GM12890  Ribosome profiles of human lymphoblastoid cell line GM12890 (Cenik et al. 2015)   Schema 
     GM12891  Ribosome profiles of human lymphoblastoid cell line GM12891 (Cenik et al. 2015)   Schema 
     GM12892  Ribosome profiles of human lymphoblastoid cell line GM12892 (Cenik et al. 2015)   Schema 
     GM18489  Ribosome profiles of human lymphoblastoid cell line GM18489 (Cenik et al. 2015)   Schema 
     GM18499  Ribosome profiles of human lymphoblastoid cell line GM18499 (Cenik et al. 2015)   Schema 
     GM18501  Ribosome profiles of human lymphoblastoid cell line GM18501 (Cenik et al. 2015)   Schema 
     GM18502  Ribosome profiles of human lymphoblastoid cell line GM18502 (Cenik et al. 2015)   Schema 
     GM18504  Ribosome profiles of human lymphoblastoid cell line GM18504 (Cenik et al. 2015)   Schema 
     GM18505  Ribosome profiles of human lymphoblastoid cell line GM18505 (Cenik et al. 2015)   Schema 
     GM18507  Ribosome profiles of human lymphoblastoid cell line GM18507 (Cenik et al. 2015)   Schema 
     GM18511  Ribosome profiles of human lymphoblastoid cell line GM18511 (Cenik et al. 2015)   Schema 
     GM18519  Ribosome profiles of human lymphoblastoid cell line GM18519 (Cenik et al. 2015)   Schema 
     GM18522  Ribosome profiles of human lymphoblastoid cell line GM18522 (Cenik et al. 2015)   Schema 
     GM18523  Ribosome profiles of human lymphoblastoid cell line GM18523 (Cenik et al. 2015)   Schema 
     GM18526  Ribosome profiles of human lymphoblastoid cell line GM18526 (Cenik et al. 2015)   Schema 
     GM18870  Ribosome profiles of human lymphoblastoid cell line GM18870 (Cenik et al. 2015)   Schema 
     GM18951  Ribosome profiles of human lymphoblastoid cell line GM18951 (Cenik et al. 2015)   Schema 
     GM19098  Ribosome profiles of human lymphoblastoid cell line GM19098 (Cenik et al. 2015)   Schema 
     GM19099  Ribosome profiles of human lymphoblastoid cell line GM19099 (Cenik et al. 2015)   Schema 
     GM19137  Ribosome profiles of human lymphoblastoid cell line GM19137 (Cenik et al. 2015)   Schema 
     GM19138  Ribosome profiles of human lymphoblastoid cell line GM19138 (Cenik et al. 2015)   Schema 
     GM19139  Ribosome profiles of human lymphoblastoid cell line GM19139 (Cenik et al. 2015)   Schema 
     GM19193  Ribosome profiles of human lymphoblastoid cell line GM19193 (Cenik et al. 2015)   Schema 
     GM19200  Ribosome profiles of human lymphoblastoid cell line GM19200 (Cenik et al. 2015)   Schema 
     GM19201  Ribosome profiles of human lymphoblastoid cell line GM19201 (Cenik et al. 2015)   Schema 
     GM19238  Ribosome profiles of human lymphoblastoid cell line GM19238 (Cenik et al. 2015)   Schema 
     GM19239  Ribosome profiles of human lymphoblastoid cell line GM19239 (Cenik et al. 2015)   Schema 
     GM19240  Ribosome profiles of human lymphoblastoid cell line GM19240 (Cenik et al. 2015)   Schema 
    

Description

Genome wide ribosome occupancy was measured in lymphoblastoid cell lines using an adapted ribosome profiling protocol.

Methods

Raw sequence data was obtained for the following cell lines from SRP055009.

GM10847:EBV-transformed lymphoblastoid cell line
GM12878:EBV-transformed lymphoblastoid cell line (2 replicates)
GM12890 EBV-transformed lymphoblastoid cell line (2 replicates)
GM12891 EBV-transformed lymphoblastoid cell line (2 replicates)
GM12892 EBV-transformed lymphoblastoid cell line (2 replicates)
GM18489 EBV-transformed lymphoblastoid cell line
GM18499 EBV-transformed lymphoblastoid cell line (2 replicates)
GM18501 EBV-transformed lymphoblastoid cell line (2 replicates)
GM18502 EBV-transformed lymphoblastoid cell line
GM18504 EBV-transformed lymphoblastoid cell line (2 replicates)
GM18505 EBV-transformed lymphoblastoid cell line
GM18507 EBV-transformed lymphoblastoid cell line
GM18511 EBV-transformed lymphoblastoid cell line
GM18519 EBV-transformed lymphoblastoid cell line
GM18522 EBV-transformed lymphoblastoid cell line (2 replicates)
GM18523 EBV-transformed lymphoblastoid cell line (2 replicates)
GM18526 EBV-transformed lymphoblastoid cell line (3 replicates)
GM18870 EBV-transformed lymphoblastoid cell line
GM18951 EBV-transformed lymphoblastoid cell line (3 replicates)
GM19098 EBV-transformed lymphoblastoid cell line (2 replicates)
GM19099 EBV-transformed lymphoblastoid cell line 
GM19137 EBV-transformed lymphoblastoid cell line (2 replicates)
GM19138 EBV-transformed lymphoblastoid cell line (2 replicates)
GM19139 EBV-transformed lymphoblastoid cell line
GM19193 EBV-transformed lymphoblastoid cell line
GM19200 EBV-transformed lymphoblastoid cell line
GM19201 EBV-transformed lymphoblastoid cell line
GM19238 EBV-transformed lymphoblastoid cell line (2 replicates)
GM19239 EBV-transformed lymphoblastoid cell line (2 replicates)
GM19240 EBV-transformed lymphoblastoid cell line (3 replicates)

Adaptor sequence AGATCGGAAGAGCACACGTCT has been removed from reads. An alignment to ribosomal RNA was performed using Bowtie, and aligning reads were discarded. An alignment to the hg38 genome assembly was then performed using Bowtie, and these tracks contain the uniquely mapping reads that align to the A-site (using an offset of 15nt).

References

C. Cenik, E.S.Cenik,G.W.Byeon, F.Grubert, S.Candille, D.Spacek,B.Alsallakh, H.Tilgner,C.L.Araya, H.Tang, E.Ricci, M.P.Snyder,(2015).Integrative analysis of RNA, translation and protein levels reveals distinct regulatory variation across humans