U2OS: Elkon 2015 Track Settings
 
Myc coordinates transcription and translation to enhance transformation and suppress invasiveness. (Elkon et al. 2015)   (All Elongating Ribosomes (Footprints) tracks)

Display mode:       Reset to defaults

Overlay method:
Type of graph:
Track height: pixels (range: 11 to 128)
Data view scaling: Always include zero: 
Vertical viewing range: min:  max:   (range: 0 to 127)
Transform function:Transform data points by: 
Windowing function: Smoothing window:  pixels
Negate values:
Draw y indicator lines:at y = 0.0:    at y =
Graph configuration help
List subtracks: only selected/visible    all  
     Crp  Ribosome Coverage of elongating ribosomes from Homo sapiens (Elkon et al. 2015)   Schema 
     Mycrp  Ribosome Coverage of elongating ribosomes from Homo sapiens (Elkon et al. 2015)   Schema 
     MycTorinrp  Ribosome Coverage of elongating ribosomes from Homo sapiens (Elkon et al. 2015)   Schema 
     Torinrp  Ribosome Coverage of elongating ribosomes from Homo sapiens (Elkon et al. 2015)   Schema 

Description

We measure ribosome occupancy profiles in U2OS cells containing an inducible Myc expression vector that were induced or mock-treated in duplicates for 36 hours. In addition, we repeated the experiments in the presence of Torin-1, an inhibitor of mTOR.

Methods

Raw sequence data were obtained from NCBI FTP directory(SRP056200). Data from the following samples were processed:

Torinrp Ribosome coverage data from Homo sapiens(Elkon, et al. 2015)
Mycrp Ribosome coverage data from Homo sapiens(Elkon, et al. 2015)
MycTorinrp Ribosome coverage data from Homo sapiens(Elkon, et al. 2015)
Crp Ribosome coverage data from Homo sapiens(Elkon, et al. 2015)

Adapter sequence TGGAATTCTCGGGTGCCAAGG was removed from reads using CutadaptAn alignment to ribosomal RNA was performed using Bowtie, and aligning reads were discarded. An alignment to the hg38 genome assembly was performed using Bowtie, and these tracks contains the uniquely mapping reads.

References

Elkon R, Loayza-Puch F, Korkmaz G, Lopes R, van Breugel PC, Bleijerveld OB, Altelaar AM, Wolf E, Lorenzin F, Eilers M, Agami R (2015) Myc coordinates transcription and translation to enhance transformation and suppress invasiveness. . Science. EMBO Rep. 2015 Dec;16(12):1723-36. doi: 10.15252/embr.201540717. Epub 2015 Nov 4.