Description We measure ribosome occupancy profiles in U2OS cells containing an inducible Myc expression vector that were induced or mock-treated in duplicates for 36 hours. In addition, we repeated the experiments in the presence of Torin-1, an inhibitor of mTOR. MethodsRaw sequence data were obtained from NCBI FTP directory(SRP056200). Data from the following samples were processed:
Torinrp | Ribosome coverage data from Homo sapiens(Elkon, et al. 2015) |
Mycrp | Ribosome coverage data from Homo sapiens(Elkon, et al. 2015) |
MycTorinrp | Ribosome coverage data from Homo sapiens(Elkon, et al. 2015) |
Crp | Ribosome coverage data from Homo sapiens(Elkon, et al. 2015) |
Adapter sequence TGGAATTCTCGGGTGCCAAGG was removed from reads using CutadaptAn alignment to ribosomal RNA was performed using Bowtie, and aligning reads were discarded. An alignment to the hg38 genome assembly was performed using Bowtie, and these tracks contains the uniquely mapping reads.
References
Elkon R, Loayza-Puch F, Korkmaz G, Lopes R, van Breugel PC, Bleijerveld OB, Altelaar AM, Wolf E, Lorenzin F, Eilers M, Agami R (2015) Myc coordinates transcription and translation to enhance transformation and suppress invasiveness. . Science. EMBO Rep. 2015 Dec;16(12):1723-36. doi: 10.15252/embr.201540717. Epub 2015 Nov 4.
|
|