HEK: Sidrauski 2015 Track Settings
 
The Small Molecule ISRIB Reverses the Effects of eIF2α Phosphorylation on Translation and Stress Granule Assembly (Sidrauski et al. 2015)   (All mRNA-seq Reads tracks)

Display mode:       Reset to defaults

Overlay method:
Type of graph:
Track height: pixels (range: 11 to 128)
Data view scaling: Always include zero: 
Vertical viewing range: min:  max:   (range: 0 to 127)
Transform function:Transform data points by: 
Windowing function: Smoothing window:  pixels
Negate values:
Draw y indicator lines:at y = 0.0:    at y =
Graph configuration help
List subtracks: only selected/visible    all  
     mrna isrib  mRNA Coverage of elongating ribosomes from Homo sapiens (Sidrauski et al. 2015)   Schema 
     mrna tm  mRNA Coverage of elongating ribosomes from Homo sapiens (Sidrauski et al. 2015)   Schema 
     mrna tmisrib  mRNA Coverage of elongating ribosomes from Homo sapiens (Sidrauski et al. 2015)   Schema 
     mrna untr  mRNA Coverage of elongating ribosomes from Homo sapiens (Sidrauski et al. 2015)   Schema 

Description

Ribosome profiling with paired RNA-seq.

Methods

Raw sequence data were obtained from NCBI FTP directory(SRP053402). Data from the following samples were processed:

mrna_tmisrib mRNA-seq unique mappers from Homo sapiens(Sidrauski, et al. 2015)
mrna_isrib mRNA-seq unique mappers from Homo sapiens(Sidrauski, et al. 2015)
mrna_tm mRNA-seq unique mappers from Homo sapiens(Sidrauski, et al. 2015)
mrna_untr mRNA-seq unique mappers from Homo sapiens(Sidrauski, et al. 2015)

Adapter sequence CTGTAGGCACCATCAATAGATCGGA was removed from reads using CutadaptAn alignment to ribosomal RNA was performed using Bowtie, and aligning reads were discarded. An alignment to the hg38 genome assembly was performed using Bowtie, and these tracks contains the uniquely mapping reads.

References

Sidrauski C, McGeachy AM, Ingolia NT, Walter P (2015) The Small Molecule ISRIB Reverses the Effects of eIF2α Phosphorylation on Translation and Stress Granule Assembly . Elife. 2015 Feb 26;4. doi: 10.7554/eLife.05033. Research Support, N.I.H., Extramural; Research Support, Non-U.S. Gov't