From the Genomes page, you can jump to the default position of an assembly by clicking the "Go" button or you can specify a particular genome position in a variety of formats. These same formats are valid in the search bar above the main Genome Browser track display.
Valid position queries can include:
To specify a genome position:
Note: A query may have multiple results. If this is the case, a results page will appear listing each result along with the track it is associated with. Once selected, the result will be displayed in the Browser with a highlighted tag, making it easier to identify. Also, if you have further questions, you can search the Genome Browser FAQ page and find links to further resources.
Below is a list of examples that might be used to query the Genome Browser. Note that not every query listed here will produce a result in every assembly. The list serves only to illustrate the different types of queries that can be performed.
| Query | Genome Browser Response |
|---|---|
| chr7 | Displays all of chromosome 7 |
| chr3:1-1000000 | Displays the first million bases of chromosome 3, counting from the p-arm telomere |
| 3:1-1000000 | Displays the first million bases of chromosome 3, Ensembl format chromosome names |
| chr3 0 1000000 | Displays the first million bases of chromosome 3; BED format |
| NC_000007.14:1-1000000 | Displays the first million bases of chromosome 3, RefSeq format |
| CM000665.2:1-1000000 | Displays the first million bases of chromosome 3, GenBank/INSDC format |
| chr3:1000000+2000 | Displays a region of chromosome 3 that spans 2000 bases, starting with position 1000000 |
| chrUn_GL000213v1 | Displays all of the unplaced contig GL000213v1 |
| chr3_GL000221v1_random | Displays the unlocalized contig GL000221v1 |
| chr1_KN196472v1_fix | Displays all of patch fix KN196472v1 |
| 20p13 | Displays the region for band p13 on chromosome 20 |
| GTATGTAGCCACGGAGCACCATTACCTGTCACCATTACCTGAATGGCTA | Displays the first best match to this DNA sequence, e.g. chr21:33034835-33034883 for hg19 |
| AA205474 | Displays the region containing the EST with GenBank accession AA205474 in the BRCA1 cancer gene on chromosome 17 |
| AC008101 | Displays the region containing the clone with GenBank accession AC008101 |
| AF083811 | Displays the region containing the mRNA with GenBank accession number AF083811 |
| NM_017414 | Displays the region containing RefSeq identifier NM_017414 |
| NP_059110 | Displays the region containing protein accession number NP_059110 |
| PRNP | Displays the region containing HUGO Gene Nomenclature Committee identifier PRNP |
| Q99697 | Displays the region containing the alignment of the UniProt/SwissProt protein sequence with accession Q99697 (PITX2) |
| RH18061;RH80175 15q11;15q13 NM_012090.5;NM_012421.4 |
Displays the region between genome landmarks, such as the STS markers RH18061 and
RH80175, or chromosome bands 15q11 to 15q13, or SNPs NM_000310.4 and NM_012090.5. This syntax may also be used for other range queries, such as between uniquely determined ESTs, mRNAs, refSeqs, SNPS, etc. |
| NM_000310.4(PPT1):c.271_287del17insTT NM_007262.5(PARK7):c.-24+75_-24+92dup NM_006172.4(NPPA):c.456_*1delAA MYH11:c.503-14_503-12del NM_198576.4(AGRN):c.1057C>T NM_198056.3:c.1654G>T NP_002993.1:p.Asp92Glu NP_002993.1:p.D92E BRCA1 Ala744Cys BRCA1 A744C LRG_100t1:c.4G>A LRG_100t1:n.1 LRG_456p1:p.Ser190Leu LRG_321:g.16409_16461del ENST00000002596.6:c.-108-6848A>G ENSP00000005178.5:p.Val20Gly chrX:g.31500000_31600000del NR_111987:n.-1 NM_015102.5:n.3038-2 NM_001372044:c.1528_1530del |
Displays the region that matches the HGVS
expression, usually in the format <transcript or protein>:<position> <amino acid or nucleotide change> If a gene symbol is used, HGVS search will try all RefSeq transcripts to find the nucleotide or amino acid at the position indicated in the expression. If there are multiple matches, a disambiguation page will be shown. If the RefSeq sequence differs from the genome sequence, then currently the search will use the genome, not the transcript, for codon counting and amino acid / nucleotide comparison. Please contact us if this is inconvenient. |
| essv8694097 | Displays the region containing Database of Genomic Variants (DGV) |
| nssv3446126 | Displays the region containing copy number variation from cases of developmental delay |
| CTD-3071L10 | Displays the region containing NCBI clone end mappings from the NCBI Clone DB database |
| nssv16167444 | Displays the region containing common copy number genomic variations from nstd186 (NCBI Curated Common Structural Variants) |
| COSM6161404 | Displays the region containing Catalogue Of Somatic Mutations In Cancer (COSMIC) |
| nssv3395351 | Displays the region containing ClinVar Copy Number Variants in the ClinVar database |
| BRCT_assoc | Displays the region containing manually-curated Pfam-A domains found in the GENCODE Genes |
| U133A:219211_at | Displays the region containing the consensus and exemplar sequences used for the selection of probes on the Affymetrix HG-U133A chips |
| chr1 0 1000 | When entered without ":" and "-", uses 0-based, half-open coordinates (like custom tracks and internal table coordinates), so displays chr1:1-1000 |
| pseudogene mRNA | Lists transcribed pseudogenes, but not cDNAs |
| p53 | Lists mRNAs related to the p53 tumor suppressor |
| T-cell receptor | Lists mRNAs for T-cell receptor genes in GenBank |
| breast cancer | Lists mRNAs associated with breast cancer |
| homeobox caudal | Lists mRNAs for caudal homeobox genes |
| zinc finger | Lists zinc finger mRNAs |
| kruppel zinc finger | Lists only kruppel-like zinc fingers |
| huntington | Lists candidate genes associated with Huntington's disease |
| zahler | Lists mRNAs deposited by a scientist named Zahler |
| Evans,J.E. | Lists mRNAs deposited by co-author J.E. Evans |
Use this last format for author queries. Although GenBank requires the search format Evans JE, internally it uses the format Evans,J.E..